figure53 disk slices on a single disk system
3.Storing Data on a Disk.ppt
Ngày tải lên :
16/07/2014, 01:00
... ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ ... ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ ... ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ...
- 30
- 215
- 0
iec 60332-1 tests on electric cables under fire conditions - test on a single vertical insulated
Ngày tải lên :
25/12/2013, 10:59
... non-governmental organizations liaising with the IEC also participate in this preparation The IEC collaborates closely with the International Organization for Standardization (ISO) in accordance with conditions ... ộgalement aux travaux La CE1 collabore ộtroitement avec l'organisation lpternationale de Normalisation (ISO), selon des conditions fixộes par accord entre les deux organisations 2) Les dộcisions ... organisation mondiale de normalisation composộe de l'ensemble des comitộs ộlectrotechniques nationaux (Comitộs nationaux de la CEI) La CE1 a pour objet de favoriser la coopộration internationale...
- 23
- 499
- 1
iec 60332-2 tests on electric cables under fire conditions - test on a single small vertical insu
Ngày tải lên :
25/12/2013, 10:59
... insulations and sheaths of electric cables and cords (elastomeric and thermoplastic compounds) Comparative information on I E C and North American flexible cord types Mineral insulated cables and ... Révision de la présente publication Revision of this publication Le contenu technique des publications de la C E I est constamment revu par la Commission afin d'assurer qu'il reflete bien l'état actuel ... température ambiante avant l'essai Conditions d'essai L'échantillon e s t tendu e t accroché en position verticale a u centre de l'écran métallique ( v o i r article 3, point c)) Une charge de...
- 13
- 402
- 1
Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx
Ngày tải lên :
07/03/2014, 05:20
... and antisense primer sequences were 5¢-TGTGAGT CCATTAATCGATGAAACC-3¢ and 5¢-ACCTGATCG CTTGGCATCTG-3¢, respectively The probe sequence was as follows: (FAM)-AGCTGATGCTATTCAAACTCGA ACGCCTCT-(TAMRA) ... increasing concentrations (2–10 lM) of ionomycin The increase in intracellular Ca2+ concentrations was analyzed by scanning fluorometry After that time period, mM Ca2+ and ionomycin (to a final concentration ... intracellular Ca2+ concentrations (the mean values and standard deviations of three experiments are shown) (C) As measured by lactate dehydrogenase assays, treatment of A1 72 cells with lM ionomycin...
- 13
- 462
- 0
Báo cáo hóa học: " Research Article On a k-Order System of Lyness-Type Difference Equations" doc
Ngày tải lên :
22/06/2014, 19:20
... a2 a1 = λ a1 a2 + λ a3 a4 , λ a3 a4 a5 = λ a3 a4 a5 , λ a4 a5 a1 = λ a4 a5 a1 , λ a5 a1 a2 = λ a5 a1 a2 , λ a1 a2 a3 = λ a1 a2 a3 , λ a2 a3 a4 = λ a2 a3 a4 , (2.11) G Papaschinopoulos et al which ... and (2.9), we get λ a1 a5 + λ a4 a3 = λ a3 a4 + λ a5 a1 , λ a2 a1 + λ a4 a5 = λ a4 a5 + λ a1 a2 , λ a4 a5 + λ a3 a2 = λ a2 a3 + λ a4 a5 , λ a3 a2 + λ a1 a5 = λ a1 a5 + λ a2 a3 , λ a4 a3 + λ a2 ... a3 x1 (n) + a4 b + a4 a3 a1 1 + a1 b + a4 a1 a2 x2 (n) x3 (n) + a2 b + a3 a1 a2 1 + a3 b + a4 a2 a3 + a4 b + a4 a3 a1 x4 (n) x1 (n − 1) x2 (n − 1) + a1 b + a4 a1 a2 1 + a2 b + a3 a1 a2 x3 (n −...
- 13
- 308
- 0
Interfacing light and a single quantum system with a lens
Ngày tải lên :
11/09/2015, 09:06
... implementing several quantum information protocols such as photonic phase gates and quantum information transfer from a ‘flying’ photon to a stationary quantum system We started with the investigation of ... fact that all quantum operations must be unitary linear transformations on the state [21] Therefore, one cannot measure a qubit, and transfer the measured information classically to another qubit ... solid-state fabrication industry It has been speculated that a scalable, and economically feasible quantum computing device will be created with a solid-state system Despite the fact that one has...
- 134
- 268
- 0
Dynamic job shop scheduling using ant colony optimization algorithm based on a multi agent system
Ngày tải lên :
13/09/2015, 20:40
... scheme ACO ant colony optimization ACS ant colony system AC2 ant colony control Ai accessible operation list ANTS approximate non-deterministic tree search AS ant system AS rank the rank-based AS ... production management The production management and control activities in a manufacturing system can be classified as strategic, tactical and operational activities, depending on the long, medium ... as a Gantt Chart, which is a two-dimensional chart showing time along the horizontal axis and the resources along the vertical axis Each rectangle on the chart represents an operation of a job,...
- 189
- 366
- 0
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc
Ngày tải lên :
22/06/2014, 00:20
... 3a in the plan determined by H atoms, absorbed Ag atom, Si corner adatom and the rest atom Figure 3c reveals that the charge depletion and accumulation mainly occur between the Ag atom and near ... clean Si substrate, 19H-Si(111)- and isolated H atoms are calculated with the same lattice parameters and atomic positions as the relaxed Ag adsorbed 19H-Si(111)-7 surface This allows the charge ... simulation package (VASP) [31] Ab initio density functional calculations of surfaces and interfaces play a critical role in providing a nanoscopic understanding of the chemical bonding in these systems...
- 6
- 368
- 0
G.A lop 4-tuan 5(3 cot- ph)
Ngày tải lên :
17/09/2013, 07:10
... năm gia đình + Cột bên phải nói số trai , gái gia đình - Biểu đồ có năm hàng + Nhìn vào hàng thứ , ta biết gia đình cô Mai có gái + Nhìn vào hàng thứ hai , ta biết gia đình cô Lan có trai + ... nước ta thêi kú Bắc thuộc HĐc a thày ?Vì nước ta lại rơi vào tay Triệu Đà - GVnx ch a Ghi t a bảng - Phát phiếu học tập cho HS - Đ a bảng so sánh tình hình nước ta trước sau bò triều đại phong ... làm câu a , em làm thể cho thêm : - Bài : câu b , lớp làm vào + Lớp 4A tham gia nhiều lớp 4B môn ? + Lớp 4A 4B tham 5.Củng cố:(4’) 6.Dặn do: ø(1’) gia môn thể thao ? +Hướng dẫn lớp ch a - Nêu...
- 27
- 398
- 0
G.A lớp 5 Tuần 11, có ôn luyện, KNS, CKTKN
Ngày tải lên :
09/10/2013, 18:11
... (Tham khảo sách BDHSG) * Thời gian lại hướng dẫn HS làm Sách Nâng cao TV5 Tuần 10 - Trang 66 Lưu ý: Bài : v a tìm từ đồng ngh a, v a tìm từ trái ngh a Bài 3: Giải ngh a từ bụng sau phân ngh a ... theo u cầu BT3 (mục a b) Lời giải: +Từ láy âm đầu n: na ná, nai nịt, nài nỉ, nao nao, nao nức, não nuột, nắc nẻ, nắc nỏm, nắn nót, nổ, nao núng, nỉ non, nằng nặc, nơn nao, nết na, nắng nơi, nặng ... thì: Quan hệ điều kiện - kết Bài Viết tiếp vào chỗ chấm cho thành câu -Lan nói ( Lan đi) -Lan nói ( Lam làm) - Lan nói .( Mai khơng nghe.) -Lan nói ( Mai đứng im lặng.) 2.Hướng dẫn HS ch a bài:...
- 24
- 599
- 2
Tài liệu Module 5: Implementing Security on a Web Server ppt
Ngày tải lên :
24/01/2014, 10:20
... tab, under Anonymous access and authentication control, click Edit What authentication methods are enabled? Anonymous access By default, a Web site will have Anonymous and Integrated Windows authentication ... several types of authentication Using Anonymous Authentication Using Basic Authentication Making Basic Authentication More Secure Using Digest Authentication Using Integrated Windows Authentication ... Digest Authentication Topic Objective To explain what Digest authentication is and how it works Lead-in Digest authentication is a solution to many of the disadvantages of Basic authentication, and...
- 80
- 280
- 0
Tài liệu ADC’s HDSL Interface Panel combines HDSL termination, DSX-1 and DSX-3 into a single shelf doc
Ngày tải lên :
24/01/2014, 12:20
... splitters can be preinstalled or ordered separately ADC Fiber Distribution Hub – ACE-200 (576 Homes) Front of cabinet Rear of cabinet Base Cabinet Sizes Cabinet AFD ACE-100 ACE-200 ACE-400 Size ... specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent portfolio as an important corporate asset and vigorously enforces its patents Products ... Parking-lot available with terminators • Parking-lot feature provides cross-connect functionality at interconnect price • Parking-lot feature ensures connector cleanliness is maintained • 1x4,...
- 4
- 242
- 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
Ngày tải lên :
22/03/2014, 18:20
... resolution of the transition state dynamics of a chemical reaction obtained using forceclamp techniques makes a novel contribution to our understanding of protein based chemical reactions Conclusions ... increase in the reduction rate can be explained by an elongation of the disulfide bond by DxR = 0.37 Æ 0.04 , at the transition state of the SN2 chemical reaction Remarkably, the measured distance ... tris(2-carboxyethyl)phosphine (TCEP), a larger bond elongation of Dx = 0.41 Æ 0.04 at the transition state of the reaction was measured (Figure 10 B), in agreement with quantum mechanical calculations...
- 12
- 553
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
Ngày tải lên :
23/03/2014, 09:21
... transcription was calculated from the ratios of signals for transporter mRNA and GAPDH mRNA With OCT1, OCT2, and CAT4 both vectors were analyzed alongside on a single blot OCT, organic cation transporter; ... fusion proteins tetracycline-controlled transcriptional activator (tTA) [10] or reverse tetracycline-controlled transcriptional activator (rtTA) [8] A third system [11] is based on concomitant ... K, Kanai M, Saya H, Kozu T & Berns A (2001) A novel tetracycline-dependent transactivator with E2F4 transcriptional activation domain Nucleic Acids Res 29, E23 14 Ivanova L, Brandli J, Saudan...
- 8
- 331
- 0
Báo cáo Y học: A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo pot
Ngày tải lên :
31/03/2014, 08:20
... CTCACCGGTATACCGCCGGCGCGAG-3¢, at position 1251, 5¢-NotI/NheI (5¢–GCTCGCGGCCGCAGCTAGCA AACCGGAACGTTCAGG-3¢), at position 1277, and 3¢-EcoRI (5¢-TACGACGAATTCGGCCAGATCAAG GC-3¢), at position 1359 over the area to be ... pexoSa (forward): 5¢-CGGAGAAACTCGAGGAGAAGGCAACCATC-3¢, pexoSb (reverse): 5¢-GTCTTTCTGGTACCACCGGTCA GGCCAGA-3¢ pMF419 and pMF420 were obtained by replacing the C-terminal ClaI/KpnI fragment from ... G-protein Ras – as a readout [35] Secondly, we employed a cytotoxicity assay, since the ADPribosylation activity of ExoS mediates a marked change in cell morphology and has a lethal activity upon translocation...
- 9
- 394
- 0
Báo cáo hóa học: " Si nanowires by a single-step metal-assisted chemical etching process on lithographically defined areas: formation kinetics" docx
Ngày tải lên :
20/06/2014, 22:20
... formed on the blank Si wafer and on lithographically defined areas Cross-sectional SEM images of SiNWs fabricated on non-patterned Si areas (a) and on 100 × 100-μm2 lithographically defined areas ... formation rate of SiNWs on non-patterned and on lithographically defined areas Arrhenius plots of the etch rate of Si by MACE as a function of temperature in the case of non-patterned areas (dark ... stays constant all along the surface Figure A schematic representation and SEM images of SiNWs formed on the confined area (a, b, c) show the process flow for SiNW formation by MACE on the confined...
- 8
- 395
- 0
3 Key Tips on How to Draw a Nose Made Easy pdf
Ngày tải lên :
29/06/2014, 00:20
... while a thin nose may have long skinny nostrils It may take some practice and observation before you become proficient at this part of the nose Really, once you start looking at and studying all ... when drawing mouths, but that's another lesson What you want to is draw the nose with lines that suggest the shape but don't create hard outlines There are many different ways to draw a nose, ... look at when learning to draw, especially when learning how to draw a nose, I have created a downloadable reference file for you to use It has all the different angles of the nose as well as some...
- 5
- 452
- 0
ĐỀ ÔN HSG 5/3
Ngày tải lên :
04/07/2014, 04:00
... 2 Có ba thùng gạo Lấy 1 số gạo thùng A đổ vào thùng B; đổ số gạo thùng B sang số gạo thùng C sang thùng A thùng có 18kg gạo Hỏi lúc đầu 10 thùng có kg gạo? Cho hình vẽ bên, A M B ABCD hình ... hình chữ nhật; MB = AB Diện tích tam giác MBC = 9cm2 Ô a) Tính diện tích tam giác MOB b) Trên BC lấy N cho NB = NC; DN cắt MC I Tính diện tích tam giác DOI D C thùng C, sau lại đổ ...
- 2
- 199
- 0
Giáo án Tiếng Việt 3 - TẬP VIẾT - ÔN CHỮ HOA Ă, Â ppt
Ngày tải lên :
06/07/2014, 17:21
... thiệu bài: ( p hút) C ÁC H T HỨC T I Ế N HÀNH Lu yện viết chữ hoa Ă, 2.Huớng dẫn viế t bảng con: ( 13 ph út ) a) Luyện viết chữ hoa A - HS: viết g - H+G: nhận xét b) Luyện viết từ ứng dụng - HS: ... thích câu ứng dụng - HS: viết bảng : Ăn khoai, Ăn 3.Viết bài: (23 phút ) - H+G: nhân xét - GV: nêu yêu cầu - HS: viết vào Chấm, c h a bài: ( 4phút ) - GV: quan sát , uốn nắn Củng cố, dặn dò: ( 2phút ... câu ứng dụn g - HS: viết chữ Ăn khoai bảng - H+G: nhận xét 3.Viết vào vở: (20 phút ) - GV: nêu yêu cầu - HS: viết vào ô ly - GV: quan sát, uốn nắn 4.Chấ m, ch a bài: (4 phút) - GV: chấm bài, nhận...
- 4
- 527
- 0
5 bài học quan trọng của cuộc đời - Bài 3: Lòng biết ơn docx
Ngày tải lên :
08/07/2014, 00:20
... đỡ? Trong đêm m a bão bất thường đường phố Alabama vắng vẻ, lúc 11h30 khuya, có bà lão da đen mặc cho roi m a quất liên hồi vào mặt, cố vẫy vẫy cánh tay để xin nhờ xe Một xe chạy vút qua, thêm ... không quên cám ơn ghi lại đ a chàng trai Bảy ngày trôi qua, cánh c a nhà chàng trai tốt bụng vang lên tiếng gõ c a Chàng trai ngạc nhiên thấy tivi khổng lồ trước c a nhà Một thư đính kèm, viết: ... để xin nhờ xe Một xe chạy vút qua, thêm xe n a, không để ý đến cánh tay dường tê cứng lạnh cóng Mặc dù vậy, bà lão hy vọng vẫy xe Một chàng trai da trắng cho bà lên xe (Mặc cho xung đột sắc tộc...
- 3
- 1.1K
- 4